Review



mda mb 231 atcc htb 26d human  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC mda mb 231 atcc htb 26d human
    Mda Mb 231 Atcc Htb 26d Human, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 24752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mda+mb+231+atcc+htb+26d+human/MDA-MB-231/pm40157365-259-189-190
    Average 99 stars, based on 24752 article reviews
    mda mb 231 atcc htb 26d human - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Staining:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Marker:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Purification:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Cell Viability Assay:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Colorimetric Assay:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    In Vitro:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Transfection:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Gene Expression:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2

    Multiple Displacement Amplification:

    Article Title: KIF2C promotes paclitaxel resistance by depolymerizing polyglutamylated microtubules.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Eribulin Sigma-Aldrich MCE-HY-13442-500UG Tubulin polyglutamylase TTLL7 (Ttll7) Recombinant Protein MyBioSource MBS1117154 Polybrene Sigma-Aldrich TR-1003 InstantBlue Coomassie Protein Stain Abcam ab119211 Protein marker Smobio PM2510 Protein Assay Dye Bio-Rad 5000006 Q-PAGE TGN Precast Gel, 12 wells, 10% Smobio QP4210 Crystal Violet Thermo Fisher Scientific B21932.36 GTP solution Jena Bioscience NU-1012 4’,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich D9542 ATP Sigma-Aldrich A26209 cOmplete His-Tag Purification Resin Roche 5893682001 Tubulin (porcine brain, >99% pure) Cytoskeleton T240-B Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega G7571 Phosphate Colorimetric Assay kit BioVision K410 PKH26 Red Fluorescent Cell Linker Kits Sigma-Aldrich PKH26GL GenJet In Vitro DNA Transfection Reagent Signagen SL100489 VECTASHIELD Antifade Mounting Medium Vector H-1000 T-Pro LumiNano Chemiluminescent Substrate Kit T-PRO JT96-K001S Deposited data GSE25066, n=508 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ PRECOG database, Vijver_BreastCancer, n=295 PRECOG https://precog.stanford.edu/ GSE41998, n=297 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GSE32646, n=115 Gene Expression Omnibus, GEO DataSets https://www.ncbi.nlm.nih.gov/geo/ GTEx tissue dataset GTExPortal https://gtexportal.org/home/ TCGA PanCancer Atlas, n=1084 cBioProtal https://www.cbioportal.org/ Experimental models: Cell lines Mouse: 4T1 ATCC CRL-2539 Mouse: 4T1 R This paper N/A Mouse: 4T1 R4 This paper N/A Mouse: 4T1 R8 This paper N/A Human: MDA-MB-231 ATCC HTB-26D Human: MDA-MB-231 R This paper N/A Human: MCF-7 ATCC HTB-22 Human: MDA-MB-468 ATCC HTB-132 Human: Hs578T ATCC HTB-126 Human: HEK293, FreeStyle 293-F Cells Thermo Fisher Scientific R79007 Experimental models: Organisms/strains Mouse: BALB/cJ BioLASCO, Taiwan N/A Oligonucleotides TRC1.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A TRC2.Scramble, CCTAAGGTTAAGTCGCCCTCG C6 RNAi Core, Academia Sinica, Taipei, Taiwan N/A (Continued on next page) Developmental Cell 60, 1–17.e1–e8, August 4, 2025 e2



    Similar Products

    mda mb 231 atcc htb 26d human  (ATCC)
    99
    ATCC mda mb 231 atcc htb 26d human
    Mda Mb 231 Atcc Htb 26d Human, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mda+mb+231+atcc+htb+26d+human/MDA-MB-231/pm40157365-259-189-190
    Average 99 stars, based on 1 article reviews
    mda mb 231 atcc htb 26d human - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results